PB PrimerBac

Streptococcus lutetiensis

Phylum:Firmicutes Class:Bacilli Order:Lactobacillales Family:Streptococcaceae Genus:Streptococcus Species:Streptococcus lutetiensis
On-target is the proportion of detected RI reference genomes assigned to the target; RI genome sensitivity is the proportion of target RI reference genomes detected.
Primer Species LP RP Tml Tmr Length Score ⇅ On-target ⇅ RI genome sensitivity ⇅
Primer 441 Streptococcus lutetiensis TGGAGCCTCACTTAAAGTCGT AGGCGACGTTTGGCTTCA 59.03 59.89 213 12
100.00%
100.00%

Showing 441 to 441   (all 45 pages)